ClustalW Guide

Purpose: A multiple sequence alignment program for DNA or proteins. Can match up to 500 sequences.

Instructions:

1) Go to http://www.ebi.ac.uk/clustalw/

2) Put in your e-mail (if you want the results e-mailed to you – not necessary) and an alignment title of your choice.

3) Paste sequences in the box below using the following format(s):

a. >Name of Sequence #1

aaatatatatatattggatgagaccctgatc

>Name of Sequence #2

aattccctctctctcgggtc

i. The sequences can have gaps and numbers but do not allow any spaces before inputting the first character.

ii. Every sequence MUST have a different name given to it or the alignment will not work.

- OR -

b. Upload a file that includes all your sequences (such as a .doc file) in an acceptable format (see above)

4) Press run button to start alignment reading.

5) When viewing your results, these are the consensus symbols used by ClustalW:

a. "*" means that the residues or nucleotides in that column are identical in all sequences in the alignment.

b. ":" means that conserved substitutions have been observed.

c. "." means that semi-conserved substitutions are observed.

6) If you would like to see your results in color, push the button that displays Show Colors. Click Hide Colors to get rid of color. A table for the color code is shown below.

7) Click on the button named View Alignment File to see the alignment on a larger scale (ie bigger font).

AVFPMILW RED Small (small+ hydrophobic (incl.aromatic -Y))

DE BLUE Acidic

RHK MAGENTA Basic

STYHCNGQ GREEN Hydroxyl + Amine + Basic - Q

Others Gray

If you have any questions, the EBI Help site is immensely helpful. You can find that here: http://www.ebi.ac.uk/clustalw/clustalw_frame.html